Cattle and aurochs mtDNA tree Build 1 (Jun 1, 2014)
Nucleotide position numbers are relative to the V00654 (BRS). Mutations are transitions unless an exact base change is specified.
Coding region mutations (np 364-15791) are shown in black; control region mutations (np 15792-16338 and 1-363) in blue.
Mutations toward a base identical-by-state to the V00654 are indicated with the prefix @.
Deletions are indicated by a "d" after the deleted nucleotide position.
Insertions are indicated by a "+" followed by the position number and type of inserted nucleotide(s).
Undetermined mutatiions are noted by "N".
Suffix "H" indicates heteroplasmy.
The mutations 16084,16085 were not considered for phylogenetic reconstruction.
The length variations in the C tract scored at np 221 (221+C, 221+CC,221+CCC) and 363 (363+C, 363+CC, 363d, 363G, 364+G), as well as the A tract scored at np 1600 (1599d, 1600d, 1600+A, 1600+AA) were not considered for phylogenetic reconstruction and are therefore excluded from the tree.
The mutations 216,231+C,234+T,16200+A and 16202+G likely due to sequencing errors in Horsburgh,K.A  et al.  PLoS ONE (2013) are not considered.
Accession numbers of sequences are in bold and italic for extinct aurochs (ancient DNA).
mt-MRCA
 
RPQT 248 518 737 1869 2953 2977 2988 2990 3051 3071 3325 3335 3535 3793 3874 3985 4000 4562 4730 4769 4871 5285 6379 6460 7358 7830 7851 8210 8308 9038 9602 10039 10066 10137 10322 10849 11068 12178 12433 12513 12672 12924 13275 13437 13554 13584 13689 13882 13909 14129 14138 14255 14411 14416 14897 15146 15308 15326 15579 15593 15605 15629 15751 16049 16058 16074 16082 16138 16247
 
PQT 8 @169 296 2979 3439 3600 6772 7330 7514 8188 8494 9005 9978 10331 11134 11419 11842 12234 12469 12622 12684 12801 12900 13056A 14825 15617 15818 16057 16121 16137 16248 16301
   
  QT 106 166 249 300 3550 5743 5890 6436 7356 10691G 15951 16122 
       
    Q 3238 3415T 7918 8318 10717A 10927 11089 12433 14108 
         
    Q1 1457
         
      Q1a 243T 11766 13620 16112                                             FJ971082
                                     
          8617 13506 @15627                                                   FJ971083 HQ184034 HQ184035
                             
        470 5716 6658 7830 12480 15090 15098A 16196                                         HQ184039
                                   
        @169 8405 11476 12377 12730 12877 12924 13819 16058 16079                                       HQ184036 HQ184037 HQ184038 EU177866 EU177867
                                 
    Q2 6436 15156 15921                                                                           FJ971080 FJ971081 HQ184033
       
      8879                                                                           HQ184030 HQ184031 HQ184032
     
    T 2558 5501 8370C 11000 12468 12675 12750 14036 15134 15627 15953G
         
    T1'2'3'6'7 13005
       
    T1 16050 16113
         
      T1a 2055+C
         
      T1a1 11188
         
        8                                                                     JN817315 JN817332
                                     
        173 4112                                                                     JN817335
       
      T1a2 3404 10561 12730
           
        T1a2a 7297
             
          15654A                                                                   JN817342
           
          16139 16302                                                                 JN817337
         
        13162                                                                     JN817333
       
      T1a3 9838
         
        754 6386 14325                                               JN817314
                             
        4165 8233 8249 11789 16133 16231                                           JN817331
                           
      T1a4 4740 7320 9602 16119 16167
           
        8 1298                                         JN817317
                                     
        8158 11954                                       JN817340
                                   
      T1a5 7066 12474
         
        352G 2023 7509 9806 12450 16141 16164                                   JN817338
                                     
        3544A 3940                                                             JN817318
               
      T1a6 8
         
        5015 5225 5812 13123 13671 14692 14903 15525                                 JN817336
                                     
        2078 10274 16058 16108 16122                                                         JN817308
                 
      T1a7 106
         
        T1a7a 8667                                         JN817344 EU177845
                                         
          1840 8196H 8859                                                         JN817345
                 
        8959 15713d 16076 16115                                                                 EU177846
       
        16016                                                                       JN817341
                                                                               
        4157 7027 8405 11428 14427 16139 16147                                                         GU947020
                 
        3682 4451 11026 15062 16246 16247                                     JN817303
                                     
        9684 12900 13423 15214 16302                                               JN817347
                             
        2582 10601 11022 14580 15974                                                JN817316
                             
        663 10517 13059 13896 16260                                               JN817312
                             
        709 9443 10855A 16264                                                                   JN817339
         
        @169 9918 13683                                                 EU177843
                             
        6046 15082                                                                     EU177844
         
        266T 13878                                                                     JN817313
       
      T1b 7542
         
      T1b1 16022
         
        T1b1a 178 14756                                                 JN817350
                                 
          5636 16291                                                           JN817351
                 
        T1b1b 14523T
             
        T1b1b1 13201 
           
          T1b1b1a 16056 
               
            T1b1b1a1 16147
               
                8H 16138                                                     JN817349
                         
                2965 9431 12360 16302                                                         JN817305
               
            T1b1b1a2 12469
                 
              T1b1b1a2a 179 1481 10460 12468                                                            KF163089
                   
                  3153H                                                           KF163094
                 
                5225 12402 14771 16057                                                         KF163075
               
            T1b1b1a3 190 497 8710 12525 13300 16316
               
              T1b1b1a3a 12468 12469
                   
                T1b1b1a3a1 16122  KF163062
                                                                             
                    6475                                                         KF163080
                   
                T1b1b1a3a2 3069 @16255 
                     
                    8188                                                         KF163066
                     
                    4361 14051                                                          KF163065
                     
                T1b1b1a3a3 3270
                   
                  T1b1b1a3a3a 12361                                                         KF163069
                       
                      4840H                                                        KF163068
                       
                      16121 16122                                                        KF163078
                       
                      216Y @12469                                                      KF163071
                     
                    3481                                                         KF163090
                   
                  173                                                         KF163067
                     
                  7622 13260                                                         KF163070 KF163091
                     
                  249 13005 15951 15953G                                                         KF163085
                 
                16122                                                             KF163086
                 
                173                                                             KF163079
                 
                3069 16057 @16255                                                           KF163064
                 
                1075C 6391 9095 16121                                                           KF163077
                 
                3270 7514 @7542 12361                                                           KF163083
             
          T1b1b1c 16148                                                                 KF163074
             
            T1b1b1c1 12468 12469                                                              KF163088
             
            15156 @16148                                                           KF163073
           
          9100 14531 14990 15844 @16050 @16255                                                     JN817302
                 
        T1b1c @16050
             
          8348 12227 16122                                             JN817324
                               
          3965 14747A 16248                                             DQ124399
                             
        T1b1d 6050 14348  KF163087
                                                                             
          12468 12469                                                                  KF163061 KF163076
         
          15419                                                                     EU177842
         
          16301                                                                     KF163063
         
          4945 10577 11530 13371A 15846 16301                                           JN817334
                             
          @169 3208 15147 15326                                                                 JN817320
         
          13395 16057 16068                                                                   KF163084
         
          9501 13260                                                                     KF163092
       
        106 7816 14051 15946 @16050 @16255                                                                 JN817327
       
        4139 5896 6703 9134 9656 9729 10603 13293 13982 16247                                                               JN817348
       
      T1c 16122
         
      T1c1 16196
         
        T1c1a 16053
           
        T1c1a1 1324 11542 16139
             
          13882                                                         JN817309
                                       
          16316                                                                 JN817310
           
          106 1874 7655 9068 16016                                         JN817322
                               
          10893A 15462                                   JN817311
                                       
          10528 10795 14457 14819 16133                                                       JN817346
                 
        T1c1b 15964
           
          4975 6932 8891 12252                                     EU177847
                                     
          3875 11473 16079 16127 16200                                   JN817300 JN817301
                                     
          352G 1879 4347 4880 6017 8326 9720 12405 12728 15419 15956                                                           JN817323
         
          3875 8523 8862 10325 11452 12651 @16122                                           EU177848
                             
          24 3404 5030 9675 14384 14598G 15326 15809                                                               JN817307
       
        10244A @16050                                                 JN817319
                           
        5186 8794A 12360 13731 16055                                                                   JN817328
       
        10496 10924 11789 16135 16206                                               JN817325
                           
        2190 8332 11961 15098 15156 16112                                                         JN817326
                 
        4586 6025 9906 10907 15460 16121                                                                   KF163072
       
      T1d 6235
         
      T1d1 4856
         
          11455                                                 JN817330
                             
          8 9512 10514 16248                                                           JN817321
                                     
          6331 7760 15147                                                                   JN817304
           
        10347 10657 12468 16121                                                                   KF163081
           
        106 1591 3189                                         JN817298
                                     
        249 4370 6451 7398 11068                                                                   JN817299
       
       
      T1e 8 @16050
           
        15939 16248                                                             JN817306
                 
        9560 15396                                                   EU177841
                             
        10597 11476 12984 13857 14325 15995+X(CATTAATGTAATAAAGACATAA) 16074 @16113 @16255                                         KC153973 KC153975
       
      T1f 12492 @16113
           
        3361 9636 11848 14210 14609 15410                                             JN817343
                             
        7755 9383 14043 15090 15404                                                                   JN817329
       
      T1g 299 3682 9201 12468 12469 16260
         
      16248                                                                        KF163082
       
      16247                                                                       KF163093
     
    T2 6202 6742 10708 16057C 16185
         
      T2a 1499 5238 8802 9383 11287
           
        4356                                                   DQ124393
                             
        @6202 15595                                                               DQ124396
             
      T2b 5146
           
        16128                                             EU177855
                                   
        173 @6202 8245 10259 16049 16113                                       EU177856
                                   
        1323 1694 2599 3718 4781 7398 10601 15157 16058 16248 16301                                         EU177857
                           
      T2c 2085 3190 9987 11734 14579
           
        169H 9480 13396 15194                                               EU177860
                             
        @169 2747 6314 8984G                                                                   EU177861
      T2d 16074
           
        1459 2558 11101 12651 15796 15985                                        EU177851
                                   
        16067 16121                                                 EU177852
                           
      170 3940 5156T 5761 10350 13751 16050 16141                                               EU177853
                           
      1651 9500 14402 16062 16247 16301                                                                   EU177854
       
      174 8514 11368 15556 16008C 16122                                               DQ124383
                           
      @587+C 3559 3560G 4106 4325 5853 7958 12270 14416                                             HQ025805
                           
      4953 5632C 16131                                                                 EU177849
             
      7850 13201 16058 16125                                                                     EU177850
       
      119 120 166 3349 3850 6403 8475 9308 10660 11830 12292 12504 12765 13480 15883d 16080 16231                                                         EU177858
       
      1553 4975 6205 8860 16139                                                                     EU177859
       
      5601 12543 15417 16077 16260                                                 AY676856
                         
    T3 16255
       
      T3a 12158
         
        T3a1 16042 16093
             
          T3a1a 15510
               
            @169                                               DQ124418
                                   
              @587+C 3559 3560G 4497G 4537 5718 5754 5853 7994 11233                                                       AY526085
             
          T4 16302
             
            T4a 11174
                 
              6688 7703 8210 12492 14907C                                       DQ124372
                                   
              9119 13231 16074                                   DQ124375
                                       
            7865 16049 16057 16104 16164                                                             DQ124377
               
              11008                                       DQ124392
                                         
              5376 10467 13509 14057                                                       DQ124400
                     
              352G 5597                                                                 DQ124401
               
              16116                                                                 DQ124412
                                 
            @169 9778T                                                                   DQ124417
           
        T3a2 8710 9480 16049 16119                                                                   DQ124371
         
      T3b 14063
         
          3334 3850A 4769 11734 12223 16127                                             DQ124385
                             
          6573 6994C                                                 DQ124416
                             
      T3c 12728
         
          1481 8169 9020 10385                                                 DQ124409
                             
          @169 8166A 10888 14132 16248                                                                   DQ124410
         
      T3d 13899
           
      T3d1 5156 13689
           
          16141                                                 AY676861
                               
          1132 16302   AY676871
                                                                           
        166 536 566 8925                                                                      GU947019
         
      T3e 10882
           
          190 12234 15579 16069 16141                                               AF492351
                               
          5224 8830 11512 13485 16138                                                                   KC153974
         
      T3f 15985d 16057+A 16074A 16076
         
        T3f1 9729
             
          T3f1a 4331
               
              5042                                    GU947008
                                               
              5224 13782T                                 GU947014
                                             
            6325 12627 13278 16231                                                                 GU947012 GU947015
           
        T3f2 190 1863 2630T 3808 5042 7239 9062 9236 16068                                           GU947011 GU947013 GU947016 GU947017
                                 
            14216 14231                                                                   GU947007
           
        T3f3 10460 16147
             
            351+G                                                 GU947010
                                 
            14216 14231                                               GU947018
                               
        T3f4 @169 5126 15194                                                                     GU947009
                           
      T3g 5716 13518
           
        2053 4754C 4755C 5602 7009 7165H 12023 12176 13089A 16136 16223 16226C GU947021
                                                                               
        173 5144 7123 8405 10600 12036 15934                                                                 AY676864
       
      T3h 10741
         
        814 2145 3302 3871 8925 13401                                         DQ124390
                                 
        106 @169 3544                                                               DQ124411
             
      T3i 1066+A 9447 14078 14561 15215
         
        14522 15419                                                 EU177822
                           
        2220 14228 15102 15386 16022 16200                                                                 EU177823
       
      T3j 13524
           
        1290 6499 6946 7799 16133 16250                                       EU177829
                                   
        312A 8880 10870 16042                                                                   EU177830
         
      T3k 12908
           
      T3k1 10889 15910 16055
           
          3086 3796 9096                                               EU177837
                               
          1132 2569 6619 9729 16112 16167                                                                 DQ124376
         
        106 3727 14580 16042 16093                                                                   DQ124386
       
      T3l 3341 7622 12023 12173 14036 15964                                               EU177833
                               
        16165H                                                   EU177834
                             
      T3n 16119                                               DQ124379
                                     
      T3n1 5944 10083 13429 16228                                               DQ124378
                               
          7779                                                                     DQ124391
           
          3856                                                                   DQ124397
         
        16113                                                                 DQ124373
               
        190 4391A 5848 6634A 16053                                                                    AY676857
       
      T3o 16122
           
      T3o1 7776 11035 12684
           
        T3o1a 8 16051                                                               DQ124381
                   
            16247                                               DQ124388 DQ124394 DQ124398
                               
          8286 13628                                           DQ124380
                                     
          8666G 12158 12684H 13029                                                           DQ124382
                 
          5681 7373G 12938H 15758                                       DQ124402
                                   
        8 1193 3718 5220A 10991 15329 16067                                             DQ124374
                             
          8916 12801 16022 16135                                                                   AY676873
         
      T3p 16057
         
          13494                                                   EU177825
                             
          5102 14594 16058 16113                                                                   EU177824
         
      T3q 16058
           
        T3q1 16231
             
          2078 2700+C 6133 8652 9515 12209 14464 16229                                   EU177826
                                     
          @169 11672 12159 13695 13743 16074 16140 16250                                                             EU177827
         
        T3q2 16119
           
          9684                                                                     DQ124384
                                     
          106 1552 4337 4385 5141 14291 16127 16247                                                               EU177828
         
      T3r 169
         
        T3r1 4901 16042
             
          173 809 3875 16231 16232                                                                 AY676868 AY676869
           
          10576 12058                                                AY676872
                             
        T3r2 1090
             
          119 4094 9068 16141                                         EU177817
                                     
          5542+A 6568 11749 13164 13401 13830 13854 15836 16042                                                             EU177818
           
          3313 9729 12021 13770 15273 16062                                           AY676858
                             
        T3r3 12705 16042
             
          3727 16302                                           EU177819
                                     
          173 2027 4000 15354 15960 16122 16228                                           EU177820
                             
      T3r4 12730
           
          7211 15556                                               DQ124408
                               
          3343 8710 12165 14906 15635 16247                                                         DQ124413 AY676866
                 
          169 11248 12879                                                                   EU177821
         
        T3r5 173
             
          1491 6930 9729 13173 16301 DQ124415
                                                                               
            15595                                                                   DQ124407
           
          5138 7135 8382 13554 15961 16057                                             AY676865
      T3r6 352G                     
           
          9134 12158                                           GQ129208
                                     
          10684 14416 16062 16247                                                                 KC153977
         
        222 9074 9116C 10347 15740 16000 16141   AY676862
                                                                               
        166 4742 16131                                                 GQ129207
                             
        3187                                                   HM045018
                             
        639 1481 11083                                                                     AY676863
         
        587+C 2536A 9682C 13310C                                         V00654
                                   
        3302 6820 9257 13140 15877                                                             EU177815
               
        163 564 10696 11026 12450 16022                                                                   EU177816
       
      T3s 8 
       
        513 4820 15092 16066 16109                                                                   EU177836
         
        13255 15987+GGACATAACATTAATGTAATAAAGACATAACATTAATGTAATAA 16076 16135                                                           JQ967333
       
      16133                                                                         EU177832
       
      4058 8061A 8063A 8064A 8067 13732 16051 16061 16129                                                                 KF926377
       
      685 14562 16112                                                   AY676859
                             
      177 16049 16050                                                   KC153972
                           
      2125 3784 16248